Review



crispr cas9 vector  (TaKaRa)


Bioz Verified Symbol TaKaRa is a verified supplier
Bioz Manufacturer Symbol TaKaRa manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95

    Structured Review

    TaKaRa crispr cas9 vector
    Crispr Cas9 Vector, supplied by TaKaRa, used in various techniques. Bioz Stars score: 95/100, based on 123 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/crispr+cas9+vector/Guide-it+CRISPR%2FCas9+System/pmc12858408-316-10-13
    Average 95 stars, based on 123 article reviews
    crispr cas9 vector - by Bioz Stars, 2026-09
    95/100 stars

    Images

    Related Articles

    CRISPR:

    Article Title: Podoplanin promotes cell proliferation, survival, and migration of canine non-tonsillar squamous cell carcinoma
    Article Snippet: .. The CRISPR/Cas9 vector used was a pGuide-it-ZsGreen1 vector (Takara Bio Inc., Shiga, Japan). .. Plasmid DNA was transfected using the Xfect transfection reagent (Takara Bio Inc.).

    Article Title: TGFβ induces an atypical EMT to evade immune mechanosurveillance in lung adenocarcinoma dormant metastasis
    Article Snippet: For analysis of Wnt-3a response, cells were cultured in media containing 2% FBS and treated with recombinant human Wnt-3a protein (R&D Systems, 5036-WN-010) at a final concentration of 200 ng ml −1 for 2 h. .. CRISPR-mediated knockouts were generated by cloning sgRNAs into the Guide-it CRISPR–Cas9 vector (Red, TaKaRa, 632602), transfecting the construct into cells and isolating and expanding the cells with knockouts from single-cell colonies. ..

    Article Title: STING inhibits the reactivation of dormant metastasis in lung adenocarcinoma
    Article Snippet: .. Knockout and overexpression constructs CRISPR-mediated knockouts were generated by cloning sgRNAs into the Guide-it CRISPR/Cas9 vector (Red, TaKaRa, Cat# 632602), transfecting the construct into cells, then isolating and expanding the cells with knockouts from single cell colonies. .. Sequences of sgRNA oligos are: hSTING.sg1 (forward CCGGGCTGGGACTGCTGTTAAACG; reverse AAACCGTTTAACAGCA GTCCCAGC), mSTING.sg1 (forward CCGGTTGATCCCCCGGAAATCGGG; reverse AAACCCC GATTTCCGGGGGATCAA), mSTING.sg2 (forward CCGGTTAGAGGAATTCGGAGTGCG; reverse AAACCGCACTCCGAATTCCTCTAA), hTGFBR2 (forward CCGGAACGTGCGGTGGG ATCGTGC; reverse AAACGCACGATCCCACCGCACGTT).

    Article Title: TGFβ induces an atypical EMT to evade immune mechanosurveillance in lung adenocarcinoma dormant metastasis.
    Article Snippet: For analysis of TGFβ responses, cells were cultured in media containing 2% FBS and incubated with SB-505124 (2.5 μM; Millipore Sigma, S4696-5MG), 100 pM TGFβ1 (R&D Systems) or 100 pM TGFβ2 (R&D Systems, 302-B2-002) for the indicated period of time. .. For analysis of Wnt-3a response, cells were cultured in media containing 2% FBS and treated with recombinant human Wnt-3a protein (R&D Systems, 5036-WN-010) at a final concentration of 200 ng ml−1 for 2 h. Gene knockout, knockdown and overexpression constructs CRISPR-mediated knockouts were generated by cloning sgRNAs into the Guide-it CRISPR–Cas9 vector (Red, TaKaRa, 632602), transfecting the construct into cells and isolating and expanding the cells with knockouts from single-cell colonies. ..

    Article Title: TGF-β induces an atypical EMT to evade immune mechanosurveillance in lung adenocarcinoma dormant metastasis
    Article Snippet: For analysis of Wnt-3a response, cells were cultured in media containing 2% FBS and treated with recombinant human Wnt-3a protein (R&D systems, Cat# 5036-WN-010) at a final concentration of 200ng/mL for 2h. .. CRISPR-mediated knockouts were generated by cloning sgRNAs into the Guide-it CRISPR/Cas9 vector (Red, TaKaRa, Cat# 632602), transfecting the construct into cells, and isolating and expanding the cells with knockouts from single-cell colonies. .. Sequences of sgRNA oligos are listed below: Lentivirus suspensions were produced by transfection of lentiviral vector with second generation packaging constructs psPAX2 and pMD2.G (Didier Trono, Addgene plasmids 12260 &12259) into 70% confluent 293T cells using Lipofectamine 2000.

    Article Title: STING inhibits the reactivation of dormant metastasis in lung adenocarcinoma
    Article Snippet: .. CRISPR-mediated knockouts were generated by cloning sgRNAs into the Guide-it CRISPR/Cas9 vector (Red, TaKaRa, Cat# 632602), transfecting the construct into cells, then isolating and expanding the cells with knockouts from single cell colonies. .. Sequences of sgRNA oligos are: hSTING.sg1 (forward CCGGGCTGGGACTGCTGTTAAACG; reverse AAACCGTTTAACAGCA GTCCCAGC), mSTING.sg1 (forward CCGGTTGATCCCCCGGAAATCGGG; reverse AAACCCC GATTTCCGGGGGATCAA), mSTING.sg2 (forward CCGGTTAGAGGAATTCGGAGTGCG; reverse AAACCGCACTCCGAATTCCTCTAA), hTGFBR2 (forward CCGGAACGTGCGGTGGG ATCGTGC; reverse AAACGCACGATCCCACCGCACGTT).

    Article Title: Loss of Calpain-2 attenuates TGF-β-driven Epithelial-Mesenchymal transition and invasive behavior in A549 lung cancer cells.
    Article Snippet: Lung cancer accounts for the highest number of cancer-related deaths globally, largely due to its high propensity for early and widespread metastasis.. Calpains, a family of calcium-dependent cysteine proteases, are involved in various physiological processes, including cytoskeletal remodeling, migration, and invasion.. Among them, calpain-2 has been implicated in promoting cancer cell invasiveness and metastatic behavior, although its precise role in non-small cell lung cancer (NSCLC) remains poorly understood.

    Generated:

    Article Title: TGFβ induces an atypical EMT to evade immune mechanosurveillance in lung adenocarcinoma dormant metastasis
    Article Snippet: For analysis of Wnt-3a response, cells were cultured in media containing 2% FBS and treated with recombinant human Wnt-3a protein (R&D Systems, 5036-WN-010) at a final concentration of 200 ng ml −1 for 2 h. .. CRISPR-mediated knockouts were generated by cloning sgRNAs into the Guide-it CRISPR–Cas9 vector (Red, TaKaRa, 632602), transfecting the construct into cells and isolating and expanding the cells with knockouts from single-cell colonies. ..

    Article Title: STING inhibits the reactivation of dormant metastasis in lung adenocarcinoma
    Article Snippet: .. Knockout and overexpression constructs CRISPR-mediated knockouts were generated by cloning sgRNAs into the Guide-it CRISPR/Cas9 vector (Red, TaKaRa, Cat# 632602), transfecting the construct into cells, then isolating and expanding the cells with knockouts from single cell colonies. .. Sequences of sgRNA oligos are: hSTING.sg1 (forward CCGGGCTGGGACTGCTGTTAAACG; reverse AAACCGTTTAACAGCA GTCCCAGC), mSTING.sg1 (forward CCGGTTGATCCCCCGGAAATCGGG; reverse AAACCCC GATTTCCGGGGGATCAA), mSTING.sg2 (forward CCGGTTAGAGGAATTCGGAGTGCG; reverse AAACCGCACTCCGAATTCCTCTAA), hTGFBR2 (forward CCGGAACGTGCGGTGGG ATCGTGC; reverse AAACGCACGATCCCACCGCACGTT).

    Article Title: TGFβ induces an atypical EMT to evade immune mechanosurveillance in lung adenocarcinoma dormant metastasis.
    Article Snippet: For analysis of TGFβ responses, cells were cultured in media containing 2% FBS and incubated with SB-505124 (2.5 μM; Millipore Sigma, S4696-5MG), 100 pM TGFβ1 (R&D Systems) or 100 pM TGFβ2 (R&D Systems, 302-B2-002) for the indicated period of time. .. For analysis of Wnt-3a response, cells were cultured in media containing 2% FBS and treated with recombinant human Wnt-3a protein (R&D Systems, 5036-WN-010) at a final concentration of 200 ng ml−1 for 2 h. Gene knockout, knockdown and overexpression constructs CRISPR-mediated knockouts were generated by cloning sgRNAs into the Guide-it CRISPR–Cas9 vector (Red, TaKaRa, 632602), transfecting the construct into cells and isolating and expanding the cells with knockouts from single-cell colonies. ..

    Article Title: TGF-β induces an atypical EMT to evade immune mechanosurveillance in lung adenocarcinoma dormant metastasis
    Article Snippet: For analysis of Wnt-3a response, cells were cultured in media containing 2% FBS and treated with recombinant human Wnt-3a protein (R&D systems, Cat# 5036-WN-010) at a final concentration of 200ng/mL for 2h. .. CRISPR-mediated knockouts were generated by cloning sgRNAs into the Guide-it CRISPR/Cas9 vector (Red, TaKaRa, Cat# 632602), transfecting the construct into cells, and isolating and expanding the cells with knockouts from single-cell colonies. .. Sequences of sgRNA oligos are listed below: Lentivirus suspensions were produced by transfection of lentiviral vector with second generation packaging constructs psPAX2 and pMD2.G (Didier Trono, Addgene plasmids 12260 &12259) into 70% confluent 293T cells using Lipofectamine 2000.

    Article Title: STING inhibits the reactivation of dormant metastasis in lung adenocarcinoma
    Article Snippet: .. CRISPR-mediated knockouts were generated by cloning sgRNAs into the Guide-it CRISPR/Cas9 vector (Red, TaKaRa, Cat# 632602), transfecting the construct into cells, then isolating and expanding the cells with knockouts from single cell colonies. .. Sequences of sgRNA oligos are: hSTING.sg1 (forward CCGGGCTGGGACTGCTGTTAAACG; reverse AAACCGTTTAACAGCA GTCCCAGC), mSTING.sg1 (forward CCGGTTGATCCCCCGGAAATCGGG; reverse AAACCCC GATTTCCGGGGGATCAA), mSTING.sg2 (forward CCGGTTAGAGGAATTCGGAGTGCG; reverse AAACCGCACTCCGAATTCCTCTAA), hTGFBR2 (forward CCGGAACGTGCGGTGGG ATCGTGC; reverse AAACGCACGATCCCACCGCACGTT).

    Article Title: Loss of Calpain-2 attenuates TGF-β-driven Epithelial-Mesenchymal transition and invasive behavior in A549 lung cancer cells.
    Article Snippet: Lung cancer accounts for the highest number of cancer-related deaths globally, largely due to its high propensity for early and widespread metastasis.. Calpains, a family of calcium-dependent cysteine proteases, are involved in various physiological processes, including cytoskeletal remodeling, migration, and invasion.. Among them, calpain-2 has been implicated in promoting cancer cell invasiveness and metastatic behavior, although its precise role in non-small cell lung cancer (NSCLC) remains poorly understood.

    Cloning:

    Article Title: TGFβ induces an atypical EMT to evade immune mechanosurveillance in lung adenocarcinoma dormant metastasis
    Article Snippet: For analysis of Wnt-3a response, cells were cultured in media containing 2% FBS and treated with recombinant human Wnt-3a protein (R&D Systems, 5036-WN-010) at a final concentration of 200 ng ml −1 for 2 h. .. CRISPR-mediated knockouts were generated by cloning sgRNAs into the Guide-it CRISPR–Cas9 vector (Red, TaKaRa, 632602), transfecting the construct into cells and isolating and expanding the cells with knockouts from single-cell colonies. ..

    Article Title: STING inhibits the reactivation of dormant metastasis in lung adenocarcinoma
    Article Snippet: .. Knockout and overexpression constructs CRISPR-mediated knockouts were generated by cloning sgRNAs into the Guide-it CRISPR/Cas9 vector (Red, TaKaRa, Cat# 632602), transfecting the construct into cells, then isolating and expanding the cells with knockouts from single cell colonies. .. Sequences of sgRNA oligos are: hSTING.sg1 (forward CCGGGCTGGGACTGCTGTTAAACG; reverse AAACCGTTTAACAGCA GTCCCAGC), mSTING.sg1 (forward CCGGTTGATCCCCCGGAAATCGGG; reverse AAACCCC GATTTCCGGGGGATCAA), mSTING.sg2 (forward CCGGTTAGAGGAATTCGGAGTGCG; reverse AAACCGCACTCCGAATTCCTCTAA), hTGFBR2 (forward CCGGAACGTGCGGTGGG ATCGTGC; reverse AAACGCACGATCCCACCGCACGTT).

    Article Title: TGFβ induces an atypical EMT to evade immune mechanosurveillance in lung adenocarcinoma dormant metastasis.
    Article Snippet: For analysis of TGFβ responses, cells were cultured in media containing 2% FBS and incubated with SB-505124 (2.5 μM; Millipore Sigma, S4696-5MG), 100 pM TGFβ1 (R&D Systems) or 100 pM TGFβ2 (R&D Systems, 302-B2-002) for the indicated period of time. .. For analysis of Wnt-3a response, cells were cultured in media containing 2% FBS and treated with recombinant human Wnt-3a protein (R&D Systems, 5036-WN-010) at a final concentration of 200 ng ml−1 for 2 h. Gene knockout, knockdown and overexpression constructs CRISPR-mediated knockouts were generated by cloning sgRNAs into the Guide-it CRISPR–Cas9 vector (Red, TaKaRa, 632602), transfecting the construct into cells and isolating and expanding the cells with knockouts from single-cell colonies. ..

    Article Title: TGF-β induces an atypical EMT to evade immune mechanosurveillance in lung adenocarcinoma dormant metastasis
    Article Snippet: For analysis of Wnt-3a response, cells were cultured in media containing 2% FBS and treated with recombinant human Wnt-3a protein (R&D systems, Cat# 5036-WN-010) at a final concentration of 200ng/mL for 2h. .. CRISPR-mediated knockouts were generated by cloning sgRNAs into the Guide-it CRISPR/Cas9 vector (Red, TaKaRa, Cat# 632602), transfecting the construct into cells, and isolating and expanding the cells with knockouts from single-cell colonies. .. Sequences of sgRNA oligos are listed below: Lentivirus suspensions were produced by transfection of lentiviral vector with second generation packaging constructs psPAX2 and pMD2.G (Didier Trono, Addgene plasmids 12260 &12259) into 70% confluent 293T cells using Lipofectamine 2000.

    Article Title: STING inhibits the reactivation of dormant metastasis in lung adenocarcinoma
    Article Snippet: .. CRISPR-mediated knockouts were generated by cloning sgRNAs into the Guide-it CRISPR/Cas9 vector (Red, TaKaRa, Cat# 632602), transfecting the construct into cells, then isolating and expanding the cells with knockouts from single cell colonies. .. Sequences of sgRNA oligos are: hSTING.sg1 (forward CCGGGCTGGGACTGCTGTTAAACG; reverse AAACCGTTTAACAGCA GTCCCAGC), mSTING.sg1 (forward CCGGTTGATCCCCCGGAAATCGGG; reverse AAACCCC GATTTCCGGGGGATCAA), mSTING.sg2 (forward CCGGTTAGAGGAATTCGGAGTGCG; reverse AAACCGCACTCCGAATTCCTCTAA), hTGFBR2 (forward CCGGAACGTGCGGTGGG ATCGTGC; reverse AAACGCACGATCCCACCGCACGTT).

    Article Title: Loss of Calpain-2 attenuates TGF-β-driven Epithelial-Mesenchymal transition and invasive behavior in A549 lung cancer cells.
    Article Snippet: Lung cancer accounts for the highest number of cancer-related deaths globally, largely due to its high propensity for early and widespread metastasis.. Calpains, a family of calcium-dependent cysteine proteases, are involved in various physiological processes, including cytoskeletal remodeling, migration, and invasion.. Among them, calpain-2 has been implicated in promoting cancer cell invasiveness and metastatic behavior, although its precise role in non-small cell lung cancer (NSCLC) remains poorly understood.

    Plasmid Preparation:

    Article Title: TGFβ induces an atypical EMT to evade immune mechanosurveillance in lung adenocarcinoma dormant metastasis
    Article Snippet: For analysis of Wnt-3a response, cells were cultured in media containing 2% FBS and treated with recombinant human Wnt-3a protein (R&D Systems, 5036-WN-010) at a final concentration of 200 ng ml −1 for 2 h. .. CRISPR-mediated knockouts were generated by cloning sgRNAs into the Guide-it CRISPR–Cas9 vector (Red, TaKaRa, 632602), transfecting the construct into cells and isolating and expanding the cells with knockouts from single-cell colonies. ..

    Article Title: TGFβ induces an atypical EMT to evade immune mechanosurveillance in lung adenocarcinoma dormant metastasis.
    Article Snippet: For analysis of TGFβ responses, cells were cultured in media containing 2% FBS and incubated with SB-505124 (2.5 μM; Millipore Sigma, S4696-5MG), 100 pM TGFβ1 (R&D Systems) or 100 pM TGFβ2 (R&D Systems, 302-B2-002) for the indicated period of time. .. For analysis of Wnt-3a response, cells were cultured in media containing 2% FBS and treated with recombinant human Wnt-3a protein (R&D Systems, 5036-WN-010) at a final concentration of 200 ng ml−1 for 2 h. Gene knockout, knockdown and overexpression constructs CRISPR-mediated knockouts were generated by cloning sgRNAs into the Guide-it CRISPR–Cas9 vector (Red, TaKaRa, 632602), transfecting the construct into cells and isolating and expanding the cells with knockouts from single-cell colonies. ..

    Article Title: Podoplanin promotes cell proliferation, survival, and migration of canine non-tonsillar squamous cell carcinoma
    Article Snippet: .. The CRISPR/Cas9 vector used was a pGuide-it-ZsGreen1 vector (Takara Bio Inc., Shiga, Japan). .. Plasmid DNA was transfected using the Xfect transfection reagent (Takara Bio Inc.).

    Article Title: Loss of Calpain-2 attenuates TGF-β-driven Epithelial-Mesenchymal transition and invasive behavior in A549 lung cancer cells.
    Article Snippet: Lung cancer accounts for the highest number of cancer-related deaths globally, largely due to its high propensity for early and widespread metastasis.. Calpains, a family of calcium-dependent cysteine proteases, are involved in various physiological processes, including cytoskeletal remodeling, migration, and invasion.. Among them, calpain-2 has been implicated in promoting cancer cell invasiveness and metastatic behavior, although its precise role in non-small cell lung cancer (NSCLC) remains poorly understood.

    Construct:

    Article Title: TGFβ induces an atypical EMT to evade immune mechanosurveillance in lung adenocarcinoma dormant metastasis
    Article Snippet: For analysis of Wnt-3a response, cells were cultured in media containing 2% FBS and treated with recombinant human Wnt-3a protein (R&D Systems, 5036-WN-010) at a final concentration of 200 ng ml −1 for 2 h. .. CRISPR-mediated knockouts were generated by cloning sgRNAs into the Guide-it CRISPR–Cas9 vector (Red, TaKaRa, 632602), transfecting the construct into cells and isolating and expanding the cells with knockouts from single-cell colonies. ..

    Article Title: STING inhibits the reactivation of dormant metastasis in lung adenocarcinoma
    Article Snippet: .. Knockout and overexpression constructs CRISPR-mediated knockouts were generated by cloning sgRNAs into the Guide-it CRISPR/Cas9 vector (Red, TaKaRa, Cat# 632602), transfecting the construct into cells, then isolating and expanding the cells with knockouts from single cell colonies. .. Sequences of sgRNA oligos are: hSTING.sg1 (forward CCGGGCTGGGACTGCTGTTAAACG; reverse AAACCGTTTAACAGCA GTCCCAGC), mSTING.sg1 (forward CCGGTTGATCCCCCGGAAATCGGG; reverse AAACCCC GATTTCCGGGGGATCAA), mSTING.sg2 (forward CCGGTTAGAGGAATTCGGAGTGCG; reverse AAACCGCACTCCGAATTCCTCTAA), hTGFBR2 (forward CCGGAACGTGCGGTGGG ATCGTGC; reverse AAACGCACGATCCCACCGCACGTT).

    Article Title: TGFβ induces an atypical EMT to evade immune mechanosurveillance in lung adenocarcinoma dormant metastasis.
    Article Snippet: For analysis of TGFβ responses, cells were cultured in media containing 2% FBS and incubated with SB-505124 (2.5 μM; Millipore Sigma, S4696-5MG), 100 pM TGFβ1 (R&D Systems) or 100 pM TGFβ2 (R&D Systems, 302-B2-002) for the indicated period of time. .. For analysis of Wnt-3a response, cells were cultured in media containing 2% FBS and treated with recombinant human Wnt-3a protein (R&D Systems, 5036-WN-010) at a final concentration of 200 ng ml−1 for 2 h. Gene knockout, knockdown and overexpression constructs CRISPR-mediated knockouts were generated by cloning sgRNAs into the Guide-it CRISPR–Cas9 vector (Red, TaKaRa, 632602), transfecting the construct into cells and isolating and expanding the cells with knockouts from single-cell colonies. ..

    Article Title: TGF-β induces an atypical EMT to evade immune mechanosurveillance in lung adenocarcinoma dormant metastasis
    Article Snippet: For analysis of Wnt-3a response, cells were cultured in media containing 2% FBS and treated with recombinant human Wnt-3a protein (R&D systems, Cat# 5036-WN-010) at a final concentration of 200ng/mL for 2h. .. CRISPR-mediated knockouts were generated by cloning sgRNAs into the Guide-it CRISPR/Cas9 vector (Red, TaKaRa, Cat# 632602), transfecting the construct into cells, and isolating and expanding the cells with knockouts from single-cell colonies. .. Sequences of sgRNA oligos are listed below: Lentivirus suspensions were produced by transfection of lentiviral vector with second generation packaging constructs psPAX2 and pMD2.G (Didier Trono, Addgene plasmids 12260 &12259) into 70% confluent 293T cells using Lipofectamine 2000.

    Article Title: STING inhibits the reactivation of dormant metastasis in lung adenocarcinoma
    Article Snippet: .. CRISPR-mediated knockouts were generated by cloning sgRNAs into the Guide-it CRISPR/Cas9 vector (Red, TaKaRa, Cat# 632602), transfecting the construct into cells, then isolating and expanding the cells with knockouts from single cell colonies. .. Sequences of sgRNA oligos are: hSTING.sg1 (forward CCGGGCTGGGACTGCTGTTAAACG; reverse AAACCGTTTAACAGCA GTCCCAGC), mSTING.sg1 (forward CCGGTTGATCCCCCGGAAATCGGG; reverse AAACCCC GATTTCCGGGGGATCAA), mSTING.sg2 (forward CCGGTTAGAGGAATTCGGAGTGCG; reverse AAACCGCACTCCGAATTCCTCTAA), hTGFBR2 (forward CCGGAACGTGCGGTGGG ATCGTGC; reverse AAACGCACGATCCCACCGCACGTT).

    Single Cell:

    Article Title: TGFβ induces an atypical EMT to evade immune mechanosurveillance in lung adenocarcinoma dormant metastasis
    Article Snippet: For analysis of Wnt-3a response, cells were cultured in media containing 2% FBS and treated with recombinant human Wnt-3a protein (R&D Systems, 5036-WN-010) at a final concentration of 200 ng ml −1 for 2 h. .. CRISPR-mediated knockouts were generated by cloning sgRNAs into the Guide-it CRISPR–Cas9 vector (Red, TaKaRa, 632602), transfecting the construct into cells and isolating and expanding the cells with knockouts from single-cell colonies. ..

    Article Title: STING inhibits the reactivation of dormant metastasis in lung adenocarcinoma
    Article Snippet: .. Knockout and overexpression constructs CRISPR-mediated knockouts were generated by cloning sgRNAs into the Guide-it CRISPR/Cas9 vector (Red, TaKaRa, Cat# 632602), transfecting the construct into cells, then isolating and expanding the cells with knockouts from single cell colonies. .. Sequences of sgRNA oligos are: hSTING.sg1 (forward CCGGGCTGGGACTGCTGTTAAACG; reverse AAACCGTTTAACAGCA GTCCCAGC), mSTING.sg1 (forward CCGGTTGATCCCCCGGAAATCGGG; reverse AAACCCC GATTTCCGGGGGATCAA), mSTING.sg2 (forward CCGGTTAGAGGAATTCGGAGTGCG; reverse AAACCGCACTCCGAATTCCTCTAA), hTGFBR2 (forward CCGGAACGTGCGGTGGG ATCGTGC; reverse AAACGCACGATCCCACCGCACGTT).

    Article Title: TGFβ induces an atypical EMT to evade immune mechanosurveillance in lung adenocarcinoma dormant metastasis.
    Article Snippet: For analysis of TGFβ responses, cells were cultured in media containing 2% FBS and incubated with SB-505124 (2.5 μM; Millipore Sigma, S4696-5MG), 100 pM TGFβ1 (R&D Systems) or 100 pM TGFβ2 (R&D Systems, 302-B2-002) for the indicated period of time. .. For analysis of Wnt-3a response, cells were cultured in media containing 2% FBS and treated with recombinant human Wnt-3a protein (R&D Systems, 5036-WN-010) at a final concentration of 200 ng ml−1 for 2 h. Gene knockout, knockdown and overexpression constructs CRISPR-mediated knockouts were generated by cloning sgRNAs into the Guide-it CRISPR–Cas9 vector (Red, TaKaRa, 632602), transfecting the construct into cells and isolating and expanding the cells with knockouts from single-cell colonies. ..

    Article Title: TGF-β induces an atypical EMT to evade immune mechanosurveillance in lung adenocarcinoma dormant metastasis
    Article Snippet: For analysis of Wnt-3a response, cells were cultured in media containing 2% FBS and treated with recombinant human Wnt-3a protein (R&D systems, Cat# 5036-WN-010) at a final concentration of 200ng/mL for 2h. .. CRISPR-mediated knockouts were generated by cloning sgRNAs into the Guide-it CRISPR/Cas9 vector (Red, TaKaRa, Cat# 632602), transfecting the construct into cells, and isolating and expanding the cells with knockouts from single-cell colonies. .. Sequences of sgRNA oligos are listed below: Lentivirus suspensions were produced by transfection of lentiviral vector with second generation packaging constructs psPAX2 and pMD2.G (Didier Trono, Addgene plasmids 12260 &12259) into 70% confluent 293T cells using Lipofectamine 2000.

    Article Title: STING inhibits the reactivation of dormant metastasis in lung adenocarcinoma
    Article Snippet: .. CRISPR-mediated knockouts were generated by cloning sgRNAs into the Guide-it CRISPR/Cas9 vector (Red, TaKaRa, Cat# 632602), transfecting the construct into cells, then isolating and expanding the cells with knockouts from single cell colonies. .. Sequences of sgRNA oligos are: hSTING.sg1 (forward CCGGGCTGGGACTGCTGTTAAACG; reverse AAACCGTTTAACAGCA GTCCCAGC), mSTING.sg1 (forward CCGGTTGATCCCCCGGAAATCGGG; reverse AAACCCC GATTTCCGGGGGATCAA), mSTING.sg2 (forward CCGGTTAGAGGAATTCGGAGTGCG; reverse AAACCGCACTCCGAATTCCTCTAA), hTGFBR2 (forward CCGGAACGTGCGGTGGG ATCGTGC; reverse AAACGCACGATCCCACCGCACGTT).

    Knock-Out:

    Article Title: STING inhibits the reactivation of dormant metastasis in lung adenocarcinoma
    Article Snippet: .. Knockout and overexpression constructs CRISPR-mediated knockouts were generated by cloning sgRNAs into the Guide-it CRISPR/Cas9 vector (Red, TaKaRa, Cat# 632602), transfecting the construct into cells, then isolating and expanding the cells with knockouts from single cell colonies. .. Sequences of sgRNA oligos are: hSTING.sg1 (forward CCGGGCTGGGACTGCTGTTAAACG; reverse AAACCGTTTAACAGCA GTCCCAGC), mSTING.sg1 (forward CCGGTTGATCCCCCGGAAATCGGG; reverse AAACCCC GATTTCCGGGGGATCAA), mSTING.sg2 (forward CCGGTTAGAGGAATTCGGAGTGCG; reverse AAACCGCACTCCGAATTCCTCTAA), hTGFBR2 (forward CCGGAACGTGCGGTGGG ATCGTGC; reverse AAACGCACGATCCCACCGCACGTT).

    Over Expression:

    Article Title: STING inhibits the reactivation of dormant metastasis in lung adenocarcinoma
    Article Snippet: .. Knockout and overexpression constructs CRISPR-mediated knockouts were generated by cloning sgRNAs into the Guide-it CRISPR/Cas9 vector (Red, TaKaRa, Cat# 632602), transfecting the construct into cells, then isolating and expanding the cells with knockouts from single cell colonies. .. Sequences of sgRNA oligos are: hSTING.sg1 (forward CCGGGCTGGGACTGCTGTTAAACG; reverse AAACCGTTTAACAGCA GTCCCAGC), mSTING.sg1 (forward CCGGTTGATCCCCCGGAAATCGGG; reverse AAACCCC GATTTCCGGGGGATCAA), mSTING.sg2 (forward CCGGTTAGAGGAATTCGGAGTGCG; reverse AAACCGCACTCCGAATTCCTCTAA), hTGFBR2 (forward CCGGAACGTGCGGTGGG ATCGTGC; reverse AAACGCACGATCCCACCGCACGTT).

    Article Title: TGFβ induces an atypical EMT to evade immune mechanosurveillance in lung adenocarcinoma dormant metastasis.
    Article Snippet: For analysis of TGFβ responses, cells were cultured in media containing 2% FBS and incubated with SB-505124 (2.5 μM; Millipore Sigma, S4696-5MG), 100 pM TGFβ1 (R&D Systems) or 100 pM TGFβ2 (R&D Systems, 302-B2-002) for the indicated period of time. .. For analysis of Wnt-3a response, cells were cultured in media containing 2% FBS and treated with recombinant human Wnt-3a protein (R&D Systems, 5036-WN-010) at a final concentration of 200 ng ml−1 for 2 h. Gene knockout, knockdown and overexpression constructs CRISPR-mediated knockouts were generated by cloning sgRNAs into the Guide-it CRISPR–Cas9 vector (Red, TaKaRa, 632602), transfecting the construct into cells and isolating and expanding the cells with knockouts from single-cell colonies. ..

    Cell Culture:

    Article Title: TGFβ induces an atypical EMT to evade immune mechanosurveillance in lung adenocarcinoma dormant metastasis.
    Article Snippet: For analysis of TGFβ responses, cells were cultured in media containing 2% FBS and incubated with SB-505124 (2.5 μM; Millipore Sigma, S4696-5MG), 100 pM TGFβ1 (R&D Systems) or 100 pM TGFβ2 (R&D Systems, 302-B2-002) for the indicated period of time. .. For analysis of Wnt-3a response, cells were cultured in media containing 2% FBS and treated with recombinant human Wnt-3a protein (R&D Systems, 5036-WN-010) at a final concentration of 200 ng ml−1 for 2 h. Gene knockout, knockdown and overexpression constructs CRISPR-mediated knockouts were generated by cloning sgRNAs into the Guide-it CRISPR–Cas9 vector (Red, TaKaRa, 632602), transfecting the construct into cells and isolating and expanding the cells with knockouts from single-cell colonies. ..

    Recombinant:

    Article Title: TGFβ induces an atypical EMT to evade immune mechanosurveillance in lung adenocarcinoma dormant metastasis.
    Article Snippet: For analysis of TGFβ responses, cells were cultured in media containing 2% FBS and incubated with SB-505124 (2.5 μM; Millipore Sigma, S4696-5MG), 100 pM TGFβ1 (R&D Systems) or 100 pM TGFβ2 (R&D Systems, 302-B2-002) for the indicated period of time. .. For analysis of Wnt-3a response, cells were cultured in media containing 2% FBS and treated with recombinant human Wnt-3a protein (R&D Systems, 5036-WN-010) at a final concentration of 200 ng ml−1 for 2 h. Gene knockout, knockdown and overexpression constructs CRISPR-mediated knockouts were generated by cloning sgRNAs into the Guide-it CRISPR–Cas9 vector (Red, TaKaRa, 632602), transfecting the construct into cells and isolating and expanding the cells with knockouts from single-cell colonies. ..

    Concentration Assay:

    Article Title: TGFβ induces an atypical EMT to evade immune mechanosurveillance in lung adenocarcinoma dormant metastasis.
    Article Snippet: For analysis of TGFβ responses, cells were cultured in media containing 2% FBS and incubated with SB-505124 (2.5 μM; Millipore Sigma, S4696-5MG), 100 pM TGFβ1 (R&D Systems) or 100 pM TGFβ2 (R&D Systems, 302-B2-002) for the indicated period of time. .. For analysis of Wnt-3a response, cells were cultured in media containing 2% FBS and treated with recombinant human Wnt-3a protein (R&D Systems, 5036-WN-010) at a final concentration of 200 ng ml−1 for 2 h. Gene knockout, knockdown and overexpression constructs CRISPR-mediated knockouts were generated by cloning sgRNAs into the Guide-it CRISPR–Cas9 vector (Red, TaKaRa, 632602), transfecting the construct into cells and isolating and expanding the cells with knockouts from single-cell colonies. ..

    Gene Knockout:

    Article Title: TGFβ induces an atypical EMT to evade immune mechanosurveillance in lung adenocarcinoma dormant metastasis.
    Article Snippet: For analysis of TGFβ responses, cells were cultured in media containing 2% FBS and incubated with SB-505124 (2.5 μM; Millipore Sigma, S4696-5MG), 100 pM TGFβ1 (R&D Systems) or 100 pM TGFβ2 (R&D Systems, 302-B2-002) for the indicated period of time. .. For analysis of Wnt-3a response, cells were cultured in media containing 2% FBS and treated with recombinant human Wnt-3a protein (R&D Systems, 5036-WN-010) at a final concentration of 200 ng ml−1 for 2 h. Gene knockout, knockdown and overexpression constructs CRISPR-mediated knockouts were generated by cloning sgRNAs into the Guide-it CRISPR–Cas9 vector (Red, TaKaRa, 632602), transfecting the construct into cells and isolating and expanding the cells with knockouts from single-cell colonies. ..

    Knockdown:

    Article Title: TGFβ induces an atypical EMT to evade immune mechanosurveillance in lung adenocarcinoma dormant metastasis.
    Article Snippet: For analysis of TGFβ responses, cells were cultured in media containing 2% FBS and incubated with SB-505124 (2.5 μM; Millipore Sigma, S4696-5MG), 100 pM TGFβ1 (R&D Systems) or 100 pM TGFβ2 (R&D Systems, 302-B2-002) for the indicated period of time. .. For analysis of Wnt-3a response, cells were cultured in media containing 2% FBS and treated with recombinant human Wnt-3a protein (R&D Systems, 5036-WN-010) at a final concentration of 200 ng ml−1 for 2 h. Gene knockout, knockdown and overexpression constructs CRISPR-mediated knockouts were generated by cloning sgRNAs into the Guide-it CRISPR–Cas9 vector (Red, TaKaRa, 632602), transfecting the construct into cells and isolating and expanding the cells with knockouts from single-cell colonies. ..



    Similar Products

    95
    TaKaRa crispr cas9 vector
    Crispr Cas9 Vector, supplied by TaKaRa, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/crispr+cas9+vector/Guide-it+CRISPR%2FCas9+System/pmc12858408-316-10-13
    Average 95 stars, based on 1 article reviews
    crispr cas9 vector - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    93
    Addgene inc april 2026 crispr cas9 vectors
    April 2026 Crispr Cas9 Vectors, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/crispr+cas9+vector/pHSE401+(Plasmid+%2362201)/pm41926706-122-29-36
    Average 93 stars, based on 1 article reviews
    april 2026 crispr cas9 vectors - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Addgene inc non sb pdg458 crispr cas9 vectors
    Non Sb Pdg458 Crispr Cas9 Vectors, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/crispr+cas9+vector/pDG458+(Plasmid+%23100900)/pmc12925242-413-30-34
    Average 93 stars, based on 1 article reviews
    non sb pdg458 crispr cas9 vectors - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    96
    Addgene inc crispr cas9 expression vector pspcas9 bb 2a gfp
    Generation of KRAS knockout clones. (A) Schematic of the <t>CRISPR/Cas9</t> strategy used to generate KRAS knockout 8988T and KP4 cell lines by targeting exon 2 of KRAS . (B) Immunoblot of RAS - less mouse embryonic fibroblasts (MEFs) reconstituted with BRAF V600E , KRAS WT , HRAS WT , or NRAS WT , confirming specificity of the anti-KRAS antibody (clone 3B10-2F2). (C) Immunoblots showing absence of KRAS protein in 8988T (K275, K328) and KP4 (K22, K63) KRAS knockout clones and baseline PI3K (pAKT) and MAPK (pERK1/2) levels relative to parental cell lines. Loading control is HSP90. Images are representative of n = 3 biological replicates. (D) Bar graphs show quantified pERK/ERK and pAKT/AKT levels relative to the parental cell line (8988T or KP4) (mean ± SEM of n = 3 biological replicates) of immunoblots in ( C ). p -values of repeated measures one-way ANOVA with Tukey’s post hoc test are shown.
    Crispr Cas9 Expression Vector Pspcas9 Bb 2a Gfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/crispr+cas9+vector/pSpCas9(BB)-2A-GFP+(PX458)+(Plasmid+%2348138)/bio_rxiv__64898__2026__03__10__710185-144-14-19
    Average 96 stars, based on 1 article reviews
    crispr cas9 expression vector pspcas9 bb 2a gfp - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    94
    Addgene inc crispr cas9 vector
    Generation of KRAS knockout clones. (A) Schematic of the <t>CRISPR/Cas9</t> strategy used to generate KRAS knockout 8988T and KP4 cell lines by targeting exon 2 of KRAS . (B) Immunoblot of RAS - less mouse embryonic fibroblasts (MEFs) reconstituted with BRAF V600E , KRAS WT , HRAS WT , or NRAS WT , confirming specificity of the anti-KRAS antibody (clone 3B10-2F2). (C) Immunoblots showing absence of KRAS protein in 8988T (K275, K328) and KP4 (K22, K63) KRAS knockout clones and baseline PI3K (pAKT) and MAPK (pERK1/2) levels relative to parental cell lines. Loading control is HSP90. Images are representative of n = 3 biological replicates. (D) Bar graphs show quantified pERK/ERK and pAKT/AKT levels relative to the parental cell line (8988T or KP4) (mean ± SEM of n = 3 biological replicates) of immunoblots in ( C ). p -values of repeated measures one-way ANOVA with Tukey’s post hoc test are shown.
    Crispr Cas9 Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/crispr+cas9+vector/pCAG-SpCas9-GFP-U6-gRNA+(Plasmid+%2379144)/pm41638907-256-9-7
    Average 94 stars, based on 1 article reviews
    crispr cas9 vector - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    97
    Addgene inc crispr cas9 sgrna
    a , Sanger sequencing of the Klhl6 locus in Cas9 + sgRNA + OT-I T cells transduced with sgCtrl , sgKlhl6 -1, or sgKlhl6 -2 in vitro. Primer sequences are listed in Supplementary Table . b , c , Mice were subcutaneously injected with 2×10 5 B16-OVA melanoma cells, followed by transfer of 3×10 Cas9 + CD8 + OT-I T cells expressing control sgRNA or sgKlhl6 (two targets) on day 9. Tumours were collected and analyzed 7 days later. Experimental design ( b ). The number of transferred Cas9 + OT-I T cells in the tumour ( c , n = 7 mice). d , e , Representative plots (left) and proportions (right) of LAG-3 + TIM-3 + TILs ( d ), and cell numbers of indicated subsets ( e ) among sgCtrl - or sgKlhl6 -transduced Cas9 + CD8 + OT-I TILs (n = 7 mice). f , g , Proportions of PD-1 + TIM-3 + ( f ) and (MTDR/MTG) lo ( g ) TILs among sgCtrl- or the indicated sgRNA- transduced Cas9 + CD8 + OT-I T cells from B16-OVA tumours (n = 6 mice). h , Schematic of <t>CRISPR/Cas9-mediated</t> generation of Klhl6 −/− mice. Guide RNA sequences are provided in Supplementary Table . i , Genotyping results for Klhl6 +/+ (WT) or Klhl6 −/− (KO) alleles. j , k , Percentages of thymocyte subsets: CD4 − CD8 − double-negative (DN), CD4 + CD8 + double-positive (DP), CD4 + single-positive (CD4SP) and CD8 + single-positive (CD8SP) ( j ), and CD44 + single-positive (DN1), CD44 + CD25 + double-positive (DN2), CD25 + single-positive (DN3) and CD44 − CD25 − double-negative (DN4) subpopulations ( k ) in DN cells of WT and KO mice (n = 6 mice). l , Numbers of CD19 + , CD4 + , and CD8 + cells in spleens of WT and KO mice (n = 6 mice). m , Percentages of naïve (CD44 lo CD62L hi ), central memory (CD44 hi CD62L hi ; CM) and effector/effector memory (CD44 hi CD62L lo , EFF/EM) CD8 + and CD4 + T cells in spleens of WT and KO mice (n = 6 mice). n , o , Proliferation of naïve WT and KO CD8 + T cells following anti-CD3/CD28 activation measured by CFSE dilution ( n ), and expression of activation markers (CD44, CD69 and CD25) at days 1-2 in vitro ( o ). p , Experimental design related to Fig. . q - s , Percentages of transferred CD45.1/2 + OT-I T cells in dLN and spleen ( q ), and quantification of PD-1, TIM-3, LAG-3, and TOX expression OT-I TILs ( r , s ) at day 14 post-ACT (n = 14 mice). t , Survival curves of tumour-bearing mice after transfer of 5×10 CD45.1/2 + WT and KO OT-I T cells (n = 13 mice). Mice with tumour volumes >1500 mm 3 were euthanized and defined as death. Diagram in b created in BioRender. Li, G. (2025) https://BioRender.com/aicmpdn . Diagram in p created in BioRender. Li, G. (2025) https://BioRender.com/0feebot . Data are presented as mean ± s.e.m. Statistical analyses were determined by unpaired two-tailed Student’s t -test ( q - s ), two-way ANOVA with Tukey’s multiple-comparisons test ( c - g ), two-way ANOVA with Sidak’s multiple-comparisons test ( j - m ), and Log-rank (Mantel-Cox) test ( t ). * P < 0.05, ** P < 0.01, *** P < 0.001, and **** P < 0.0001; ns, not significant.
    Crispr Cas9 Sgrna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/crispr+cas9+vector/Cas9+sgRNA+vector+(Plasmid+%2368463)/pmc12979199-364-3-11
    Average 97 stars, based on 1 article reviews
    crispr cas9 sgrna - by Bioz Stars, 2026-09
    97/100 stars
      Buy from Supplier

    96
    Addgene inc crispr cas9 expression vector pspcas9 bb 2 a puro
    a , Sanger sequencing of the Klhl6 locus in Cas9 + sgRNA + OT-I T cells transduced with sgCtrl , sgKlhl6 -1, or sgKlhl6 -2 in vitro. Primer sequences are listed in Supplementary Table . b , c , Mice were subcutaneously injected with 2×10 5 B16-OVA melanoma cells, followed by transfer of 3×10 Cas9 + CD8 + OT-I T cells expressing control sgRNA or sgKlhl6 (two targets) on day 9. Tumours were collected and analyzed 7 days later. Experimental design ( b ). The number of transferred Cas9 + OT-I T cells in the tumour ( c , n = 7 mice). d , e , Representative plots (left) and proportions (right) of LAG-3 + TIM-3 + TILs ( d ), and cell numbers of indicated subsets ( e ) among sgCtrl - or sgKlhl6 -transduced Cas9 + CD8 + OT-I TILs (n = 7 mice). f , g , Proportions of PD-1 + TIM-3 + ( f ) and (MTDR/MTG) lo ( g ) TILs among sgCtrl- or the indicated sgRNA- transduced Cas9 + CD8 + OT-I T cells from B16-OVA tumours (n = 6 mice). h , Schematic of <t>CRISPR/Cas9-mediated</t> generation of Klhl6 −/− mice. Guide RNA sequences are provided in Supplementary Table . i , Genotyping results for Klhl6 +/+ (WT) or Klhl6 −/− (KO) alleles. j , k , Percentages of thymocyte subsets: CD4 − CD8 − double-negative (DN), CD4 + CD8 + double-positive (DP), CD4 + single-positive (CD4SP) and CD8 + single-positive (CD8SP) ( j ), and CD44 + single-positive (DN1), CD44 + CD25 + double-positive (DN2), CD25 + single-positive (DN3) and CD44 − CD25 − double-negative (DN4) subpopulations ( k ) in DN cells of WT and KO mice (n = 6 mice). l , Numbers of CD19 + , CD4 + , and CD8 + cells in spleens of WT and KO mice (n = 6 mice). m , Percentages of naïve (CD44 lo CD62L hi ), central memory (CD44 hi CD62L hi ; CM) and effector/effector memory (CD44 hi CD62L lo , EFF/EM) CD8 + and CD4 + T cells in spleens of WT and KO mice (n = 6 mice). n , o , Proliferation of naïve WT and KO CD8 + T cells following anti-CD3/CD28 activation measured by CFSE dilution ( n ), and expression of activation markers (CD44, CD69 and CD25) at days 1-2 in vitro ( o ). p , Experimental design related to Fig. . q - s , Percentages of transferred CD45.1/2 + OT-I T cells in dLN and spleen ( q ), and quantification of PD-1, TIM-3, LAG-3, and TOX expression OT-I TILs ( r , s ) at day 14 post-ACT (n = 14 mice). t , Survival curves of tumour-bearing mice after transfer of 5×10 CD45.1/2 + WT and KO OT-I T cells (n = 13 mice). Mice with tumour volumes >1500 mm 3 were euthanized and defined as death. Diagram in b created in BioRender. Li, G. (2025) https://BioRender.com/aicmpdn . Diagram in p created in BioRender. Li, G. (2025) https://BioRender.com/0feebot . Data are presented as mean ± s.e.m. Statistical analyses were determined by unpaired two-tailed Student’s t -test ( q - s ), two-way ANOVA with Tukey’s multiple-comparisons test ( c - g ), two-way ANOVA with Sidak’s multiple-comparisons test ( j - m ), and Log-rank (Mantel-Cox) test ( t ). * P < 0.05, ** P < 0.01, *** P < 0.001, and **** P < 0.0001; ns, not significant.
    Crispr Cas9 Expression Vector Pspcas9 Bb 2 A Puro, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/crispr+cas9+vector/pSpCas9(BB)-2A-Puro+(PX459)+V2%2E0+(Plasmid+%2362988)/pm41330077-61-1-7
    Average 96 stars, based on 1 article reviews
    crispr cas9 expression vector pspcas9 bb 2 a puro - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    95
    TaKaRa crispr cas9 vectors
    a , Sanger sequencing of the Klhl6 locus in Cas9 + sgRNA + OT-I T cells transduced with sgCtrl , sgKlhl6 -1, or sgKlhl6 -2 in vitro. Primer sequences are listed in Supplementary Table . b , c , Mice were subcutaneously injected with 2×10 5 B16-OVA melanoma cells, followed by transfer of 3×10 Cas9 + CD8 + OT-I T cells expressing control sgRNA or sgKlhl6 (two targets) on day 9. Tumours were collected and analyzed 7 days later. Experimental design ( b ). The number of transferred Cas9 + OT-I T cells in the tumour ( c , n = 7 mice). d , e , Representative plots (left) and proportions (right) of LAG-3 + TIM-3 + TILs ( d ), and cell numbers of indicated subsets ( e ) among sgCtrl - or sgKlhl6 -transduced Cas9 + CD8 + OT-I TILs (n = 7 mice). f , g , Proportions of PD-1 + TIM-3 + ( f ) and (MTDR/MTG) lo ( g ) TILs among sgCtrl- or the indicated sgRNA- transduced Cas9 + CD8 + OT-I T cells from B16-OVA tumours (n = 6 mice). h , Schematic of <t>CRISPR/Cas9-mediated</t> generation of Klhl6 −/− mice. Guide RNA sequences are provided in Supplementary Table . i , Genotyping results for Klhl6 +/+ (WT) or Klhl6 −/− (KO) alleles. j , k , Percentages of thymocyte subsets: CD4 − CD8 − double-negative (DN), CD4 + CD8 + double-positive (DP), CD4 + single-positive (CD4SP) and CD8 + single-positive (CD8SP) ( j ), and CD44 + single-positive (DN1), CD44 + CD25 + double-positive (DN2), CD25 + single-positive (DN3) and CD44 − CD25 − double-negative (DN4) subpopulations ( k ) in DN cells of WT and KO mice (n = 6 mice). l , Numbers of CD19 + , CD4 + , and CD8 + cells in spleens of WT and KO mice (n = 6 mice). m , Percentages of naïve (CD44 lo CD62L hi ), central memory (CD44 hi CD62L hi ; CM) and effector/effector memory (CD44 hi CD62L lo , EFF/EM) CD8 + and CD4 + T cells in spleens of WT and KO mice (n = 6 mice). n , o , Proliferation of naïve WT and KO CD8 + T cells following anti-CD3/CD28 activation measured by CFSE dilution ( n ), and expression of activation markers (CD44, CD69 and CD25) at days 1-2 in vitro ( o ). p , Experimental design related to Fig. . q - s , Percentages of transferred CD45.1/2 + OT-I T cells in dLN and spleen ( q ), and quantification of PD-1, TIM-3, LAG-3, and TOX expression OT-I TILs ( r , s ) at day 14 post-ACT (n = 14 mice). t , Survival curves of tumour-bearing mice after transfer of 5×10 CD45.1/2 + WT and KO OT-I T cells (n = 13 mice). Mice with tumour volumes >1500 mm 3 were euthanized and defined as death. Diagram in b created in BioRender. Li, G. (2025) https://BioRender.com/aicmpdn . Diagram in p created in BioRender. Li, G. (2025) https://BioRender.com/0feebot . Data are presented as mean ± s.e.m. Statistical analyses were determined by unpaired two-tailed Student’s t -test ( q - s ), two-way ANOVA with Tukey’s multiple-comparisons test ( c - g ), two-way ANOVA with Sidak’s multiple-comparisons test ( j - m ), and Log-rank (Mantel-Cox) test ( t ). * P < 0.05, ** P < 0.01, *** P < 0.001, and **** P < 0.0001; ns, not significant.
    Crispr Cas9 Vectors, supplied by TaKaRa, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/crispr+cas9+vector/pLVX-puro-Cas9+Vector/pmc12675261-48-2-55
    Average 95 stars, based on 1 article reviews
    crispr cas9 vectors - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    Image Search Results


    Generation of KRAS knockout clones. (A) Schematic of the CRISPR/Cas9 strategy used to generate KRAS knockout 8988T and KP4 cell lines by targeting exon 2 of KRAS . (B) Immunoblot of RAS - less mouse embryonic fibroblasts (MEFs) reconstituted with BRAF V600E , KRAS WT , HRAS WT , or NRAS WT , confirming specificity of the anti-KRAS antibody (clone 3B10-2F2). (C) Immunoblots showing absence of KRAS protein in 8988T (K275, K328) and KP4 (K22, K63) KRAS knockout clones and baseline PI3K (pAKT) and MAPK (pERK1/2) levels relative to parental cell lines. Loading control is HSP90. Images are representative of n = 3 biological replicates. (D) Bar graphs show quantified pERK/ERK and pAKT/AKT levels relative to the parental cell line (8988T or KP4) (mean ± SEM of n = 3 biological replicates) of immunoblots in ( C ). p -values of repeated measures one-way ANOVA with Tukey’s post hoc test are shown.

    Journal: bioRxiv

    Article Title: Baseline cellular state dictates the molecular impact of KRAS mutant variants in pancreatic cancer cells

    doi: 10.64898/2026.03.10.710185

    Figure Lengend Snippet: Generation of KRAS knockout clones. (A) Schematic of the CRISPR/Cas9 strategy used to generate KRAS knockout 8988T and KP4 cell lines by targeting exon 2 of KRAS . (B) Immunoblot of RAS - less mouse embryonic fibroblasts (MEFs) reconstituted with BRAF V600E , KRAS WT , HRAS WT , or NRAS WT , confirming specificity of the anti-KRAS antibody (clone 3B10-2F2). (C) Immunoblots showing absence of KRAS protein in 8988T (K275, K328) and KP4 (K22, K63) KRAS knockout clones and baseline PI3K (pAKT) and MAPK (pERK1/2) levels relative to parental cell lines. Loading control is HSP90. Images are representative of n = 3 biological replicates. (D) Bar graphs show quantified pERK/ERK and pAKT/AKT levels relative to the parental cell line (8988T or KP4) (mean ± SEM of n = 3 biological replicates) of immunoblots in ( C ). p -values of repeated measures one-way ANOVA with Tukey’s post hoc test are shown.

    Article Snippet: A single-guide RNA (sgRNA) targeting KRAS exon 2 (sequence: 5’-AATTACTACTTGCTTCCTGT-3’) was cloned into the CRISPR-Cas9 expression vector pSpCas9(BB)-2A-GFP (PX458, Addgene plasmid #48138).

    Techniques: Knock-Out, Clone Assay, CRISPR, Western Blot, Control

    a , Sanger sequencing of the Klhl6 locus in Cas9 + sgRNA + OT-I T cells transduced with sgCtrl , sgKlhl6 -1, or sgKlhl6 -2 in vitro. Primer sequences are listed in Supplementary Table . b , c , Mice were subcutaneously injected with 2×10 5 B16-OVA melanoma cells, followed by transfer of 3×10 Cas9 + CD8 + OT-I T cells expressing control sgRNA or sgKlhl6 (two targets) on day 9. Tumours were collected and analyzed 7 days later. Experimental design ( b ). The number of transferred Cas9 + OT-I T cells in the tumour ( c , n = 7 mice). d , e , Representative plots (left) and proportions (right) of LAG-3 + TIM-3 + TILs ( d ), and cell numbers of indicated subsets ( e ) among sgCtrl - or sgKlhl6 -transduced Cas9 + CD8 + OT-I TILs (n = 7 mice). f , g , Proportions of PD-1 + TIM-3 + ( f ) and (MTDR/MTG) lo ( g ) TILs among sgCtrl- or the indicated sgRNA- transduced Cas9 + CD8 + OT-I T cells from B16-OVA tumours (n = 6 mice). h , Schematic of CRISPR/Cas9-mediated generation of Klhl6 −/− mice. Guide RNA sequences are provided in Supplementary Table . i , Genotyping results for Klhl6 +/+ (WT) or Klhl6 −/− (KO) alleles. j , k , Percentages of thymocyte subsets: CD4 − CD8 − double-negative (DN), CD4 + CD8 + double-positive (DP), CD4 + single-positive (CD4SP) and CD8 + single-positive (CD8SP) ( j ), and CD44 + single-positive (DN1), CD44 + CD25 + double-positive (DN2), CD25 + single-positive (DN3) and CD44 − CD25 − double-negative (DN4) subpopulations ( k ) in DN cells of WT and KO mice (n = 6 mice). l , Numbers of CD19 + , CD4 + , and CD8 + cells in spleens of WT and KO mice (n = 6 mice). m , Percentages of naïve (CD44 lo CD62L hi ), central memory (CD44 hi CD62L hi ; CM) and effector/effector memory (CD44 hi CD62L lo , EFF/EM) CD8 + and CD4 + T cells in spleens of WT and KO mice (n = 6 mice). n , o , Proliferation of naïve WT and KO CD8 + T cells following anti-CD3/CD28 activation measured by CFSE dilution ( n ), and expression of activation markers (CD44, CD69 and CD25) at days 1-2 in vitro ( o ). p , Experimental design related to Fig. . q - s , Percentages of transferred CD45.1/2 + OT-I T cells in dLN and spleen ( q ), and quantification of PD-1, TIM-3, LAG-3, and TOX expression OT-I TILs ( r , s ) at day 14 post-ACT (n = 14 mice). t , Survival curves of tumour-bearing mice after transfer of 5×10 CD45.1/2 + WT and KO OT-I T cells (n = 13 mice). Mice with tumour volumes >1500 mm 3 were euthanized and defined as death. Diagram in b created in BioRender. Li, G. (2025) https://BioRender.com/aicmpdn . Diagram in p created in BioRender. Li, G. (2025) https://BioRender.com/0feebot . Data are presented as mean ± s.e.m. Statistical analyses were determined by unpaired two-tailed Student’s t -test ( q - s ), two-way ANOVA with Tukey’s multiple-comparisons test ( c - g ), two-way ANOVA with Sidak’s multiple-comparisons test ( j - m ), and Log-rank (Mantel-Cox) test ( t ). * P < 0.05, ** P < 0.01, *** P < 0.001, and **** P < 0.0001; ns, not significant.

    Journal: Nature

    Article Title: The ubiquitin ligase KLHL6 drives resistance to CD8 + T cell dysfunction

    doi: 10.1038/s41586-025-09926-8

    Figure Lengend Snippet: a , Sanger sequencing of the Klhl6 locus in Cas9 + sgRNA + OT-I T cells transduced with sgCtrl , sgKlhl6 -1, or sgKlhl6 -2 in vitro. Primer sequences are listed in Supplementary Table . b , c , Mice were subcutaneously injected with 2×10 5 B16-OVA melanoma cells, followed by transfer of 3×10 Cas9 + CD8 + OT-I T cells expressing control sgRNA or sgKlhl6 (two targets) on day 9. Tumours were collected and analyzed 7 days later. Experimental design ( b ). The number of transferred Cas9 + OT-I T cells in the tumour ( c , n = 7 mice). d , e , Representative plots (left) and proportions (right) of LAG-3 + TIM-3 + TILs ( d ), and cell numbers of indicated subsets ( e ) among sgCtrl - or sgKlhl6 -transduced Cas9 + CD8 + OT-I TILs (n = 7 mice). f , g , Proportions of PD-1 + TIM-3 + ( f ) and (MTDR/MTG) lo ( g ) TILs among sgCtrl- or the indicated sgRNA- transduced Cas9 + CD8 + OT-I T cells from B16-OVA tumours (n = 6 mice). h , Schematic of CRISPR/Cas9-mediated generation of Klhl6 −/− mice. Guide RNA sequences are provided in Supplementary Table . i , Genotyping results for Klhl6 +/+ (WT) or Klhl6 −/− (KO) alleles. j , k , Percentages of thymocyte subsets: CD4 − CD8 − double-negative (DN), CD4 + CD8 + double-positive (DP), CD4 + single-positive (CD4SP) and CD8 + single-positive (CD8SP) ( j ), and CD44 + single-positive (DN1), CD44 + CD25 + double-positive (DN2), CD25 + single-positive (DN3) and CD44 − CD25 − double-negative (DN4) subpopulations ( k ) in DN cells of WT and KO mice (n = 6 mice). l , Numbers of CD19 + , CD4 + , and CD8 + cells in spleens of WT and KO mice (n = 6 mice). m , Percentages of naïve (CD44 lo CD62L hi ), central memory (CD44 hi CD62L hi ; CM) and effector/effector memory (CD44 hi CD62L lo , EFF/EM) CD8 + and CD4 + T cells in spleens of WT and KO mice (n = 6 mice). n , o , Proliferation of naïve WT and KO CD8 + T cells following anti-CD3/CD28 activation measured by CFSE dilution ( n ), and expression of activation markers (CD44, CD69 and CD25) at days 1-2 in vitro ( o ). p , Experimental design related to Fig. . q - s , Percentages of transferred CD45.1/2 + OT-I T cells in dLN and spleen ( q ), and quantification of PD-1, TIM-3, LAG-3, and TOX expression OT-I TILs ( r , s ) at day 14 post-ACT (n = 14 mice). t , Survival curves of tumour-bearing mice after transfer of 5×10 CD45.1/2 + WT and KO OT-I T cells (n = 13 mice). Mice with tumour volumes >1500 mm 3 were euthanized and defined as death. Diagram in b created in BioRender. Li, G. (2025) https://BioRender.com/aicmpdn . Diagram in p created in BioRender. Li, G. (2025) https://BioRender.com/0feebot . Data are presented as mean ± s.e.m. Statistical analyses were determined by unpaired two-tailed Student’s t -test ( q - s ), two-way ANOVA with Tukey’s multiple-comparisons test ( c - g ), two-way ANOVA with Sidak’s multiple-comparisons test ( j - m ), and Log-rank (Mantel-Cox) test ( t ). * P < 0.05, ** P < 0.01, *** P < 0.001, and **** P < 0.0001; ns, not significant.

    Article Snippet: In this study, CRISPR–Cas9 sgRNA was expressed using pSL21-Thy1.1 or pSL21-mCherry (Addgene, 164410) . sgRNAs were generated by annealing two DNA oligos and then ligated into the pSL21-Thy1.1 or pSL21-mCherry vector after digestion with BbsI.

    Techniques: Sequencing, Transduction, In Vitro, Injection, Expressing, Control, CRISPR, Activation Assay, Two Tailed Test